-
Notifications
You must be signed in to change notification settings - Fork 14
Lookup_table
This software is designed to query k-mers from extendors/compactors/fasta files against reference sequences.
The first step is to build an index for a given set of reference sequences. This index is further used to perform queries.
To build an index one should use build_lookup_table.py script.
Let's use three simple example files:
1.fa:
>h1-cat_1
ACGACGACGACG
>h2-cat_2
ACGACGACGACT
>h3-cat_2
ACGACGACGACT
>h4-cat_3
ACGACTGCGACG
>h5-cat_4
TGATGATGATGA
>h6-cat_4
TGATGATGATGA
>h7-cat_4
TGATGATGATGA
>h8-poly
AAAAAAAACCCC
>h9
CGACTGCGACGG
,
2.fa:
>h1-cat_1
ACGCCGACGACG
>h2-cat_2
TCGCCGACGACG
>h3-cat_2
TCGCCGACGACG
>h4-cat_2
TCGCCGACGACG
>h5-cat_3
ACGACTGCGACG
, and 3.fa:
>h1-cat_3
ACGACTGCGACG
>h2-cat_3
ACGACTGCGACG
>h3-cat_4
TGATGATGATGA
>h4-cat_4
TGATGATGATGA
>h5-cat_4
TGATGATGATGA
Let's put paths to these files in input.txt:
1.fa
2.fa
3.fa
To build an index of 12-mers without any poly sequences of length at least 6 one may use:
./build_lookup_table.py --poly_ACGT_len 6 --kmer_len 12 input.txt
The resulting index is a single file: lookup.slt (slt extension stands for splash lookup table).
The default output file name may be overwritten with --outname.
The full usage of build_lookup_table.py is:
-h, --help show this help message and exit
--transcriptomes TRANSCRIPTOMES
path to additional (optional) file where transcriptome input FASTA files are defined, the format is: per each line path to fasta file (default: )
--outname OUTNAME prefix of output file names (default: lookup.slt)
--kmer_len KMER_LEN k-mer length (default: 15)
--bin_path BIN_PATH path to a directory where kmc, kmc_tools (default: .)
--n_threads N_THREADS
number of threads (default: 8)
--poly_ACGT_len POLY_ACGT_LEN
all k-mers containing polyACGT of this length will be filtered out (0 means no filtering) (default: 0)
--category_3_threshold CATEGORY_3_THRESHOLD
accept k-mer in category 3 if its present in a given file <=category_3_threshold times (default: 1)
--precomputed_sbwt PRECOMPUTED_SBWT
path to precomputed sbwt index (if set lookup_table will use it instead of building own sbwt - must be build for exactly the same set of input files!) (default: )
--dont_clean_up if set then intermediate files will not be removed (default: False)
This is currently not supported and the whole index should be rebuilt.
To query the index one should use lookup_table program in query mode.
It expects three parameters:
Input:
-
input- input file with sequences to be queried -
lookup- path to a index being a result of runningbuild_lookup_table.py
Output:
-
output- path to the output text file
It also provides additional configuration:
-
--input_fmt <format>- input format, one of:fasta,extendors,compactors(default: fasta) -
--report_fmt <string>- format of the detailed report, one of: plain (verbose format), concise (default), ids (just ids), empty (do not report, useful when stats enabled with stats_fmt) (default: concise) -
--stats_fmt <string>- for each query report stats (#k-mers per category) one of: empty (don't print stats) or with_stats (print stats) (default: empty) -
--output_fmt <string>- output format, one of: txt (one line for each query), extendors (only for extendors input, adds additional columns to the extendors file), compactors (only for compactors input, adds additional columns to the compactors file) (default: txt) -
--kmer_skip <int>- for each query the next queried k-mer start on position <kmer_skip> + 1 -
--truncate_paths- if set the files paths will be truncated to file names only
Let's say we have a file 4.fa:
>
ANACGACGACGACGTACGCCGACGACG
>
ACGACGACGACT
>
AAAAAACGACTGCGACG
>
TGATGATGATGA
that we want to use to perform queries. To do this one may use the following command:
./lookup_table query --report_fmt plain 4.fa lookup.slt o.txt
The resulting file o.txt:
N, N, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1")
2: ("1.fa", 2)
P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]]
4
Each line corresponds to a single input sequence.
Categories of k-mers are defined as as below:
- k-mer is unique to a single fasta and also appears once in it (report the type and the fasta where it is unique)
- k-mer is unique to a single fasta appears multiple times in it (report the type and the fasta where it appears and report # times it appears)
- k-mer is unique in that it appears once in one fasta but also appears in other fastas (report the type and the header where it appears)
- Appears >1 in >1 fasta
For each k-mer we report its state using the following convention:
-
1: ("<file_path>","<header>")- k-mer is in category 1 and its file and header is reported -
2: ("<file_path>", <cnt>)- k-mer is in category 2 and its file and count is reported -
3: ["<file_1>": ["<header_in_file1>"], "<file_2>": ["header_in_file2"], ...]- k-mer is in category 3 and for each file it occurs only once report the file and header -
4- k-mer is in category 4 -
U- unknown, means that a given k-mers was not observed in any of the references used to build an index -
P- means k-mer contains polyACGT sequence of length at least equal to the one used to build an index -
N- means this k-mer contains at least one non-ACGT symbol, note that a singleNin a query sequence may produce up tokinvalid k-mers
The states are comma separated. The number of states per each sequence is len(sequence) - k + 1.
Note that in the above example --report_fmt plain was used.
This is because its easier to explain the results for this format, but in practice the output in this mode is verbose (because very often consecutive k-mers have the exact same category).
By default concise report format is used.
So if query is like below:
./lookup_table query 4.fa lookup.slt o2.txt
The resulting o2.txt file is:
1:<2:1>:"h1-cat_1", 1:<15:1>:"h1-cat_1"
2:<0:1>:"1.fa"
3:<5:1>:["h4-cat_3", "h5-cat_3"]
4:<0:1>
In this format only categories 1, 2, 3, and 4 are reported (U, P, and N are skipped).
Each category is reported as:
CAT:<POS_IN_QUERY:NUM_KMERS>:DETAILS
CAT is one of 1, 2, 3, 4.
POS_IN_QUERY is a 0-based position in a query where a series of consecutive NUM_KMERS k-mers with the same category (CAT) and the same metadata (DETAILS) starts.
DETAILS depends on category (CAT) as follows:
- If
CAT = 1theDETAILSis a"<header>", - If
CAT = 2theDETAILSis a"<file_path>", - If
CAT = 3theDETAILSis list of"<header>"s, - If
CAT = 4theDETAILSis empty.
It is possible to increase the acceptance into the category three threshold using --category_3_threshold parameter in build_lookup_table.py (default 1). In such a case a list of headers for a given k-mer and given file in category three may be longer. In other words, some of k-mers instead of being classified into category 4 will be classified into category 3.
To use transcriptomes fasta file one should use --transcriptomes switch. Each transcriptome file is handled a little differently than other files.
Warning The transcriptome files should be probably only contained in the file pointed by --transcriptomes switch and not in the regular input file.
If it is in both it will be read twice and treated once as transcriptome and once as non-transcriptome.
If one needs to only use transcriptome files the regular input file may be empty, but still must be provided to the build script.
The rules to assign k-mers to categories are as follows:
-
If k-mer exists in only single variant of single gene (so basicaly in single header) and
a. it exists only in a single file it is stored in category 1 with gene variant name, or
b. it exists in at least one other file, it is stored in category 3 with gene variant name.
-
If k-mer exists only in a single gene, but in multiple variants and
a. it exists only in a single file it is stored in category 1 with gene name, or
b. it exists in at least one other file, it is stored in category 3 with gene name.
-
If k-mer exists in multiple genes and it exists only in a single file it is stored in category 2 with transcriptome file name and number of its occurences.
There are currently two ways of extracting gene name.
If there is ( character in the header The parentheses method is used in the opposite case the dot/dash method is used.
-
If there is only one
(something)in the header this is a gene name -
In the opposite case
2a. If there is a
transcript variantin the header I remove the line starting with this text (transcript variant) to the end <- because for some headers there were()after transcript variant which I believe are not gene names2b. I read the content of the last
(something)in the (optionally trimmed in 2a) line and this is a gene name
- Split the header by whitespace and take the first part for the next steps.
- If there is
.in the part the gene name is everything from the beginning to the. - In the opposite case if there is
-in the part the gene name is everything from the beginning to the- - In the opposite case the gene name is the part
I'm not sure if this parsing is fine and if this is consistent for other transcriptome files. Please feel free to post issues in that matter.
Transcriptome handling is currently experimental and may change, also if there are any performance/memory usage-related issues please post an issue with details
Let's say we want to extend the previous example of a transcriptome file.
Let's assume we have a file genes.fa with content
>AB_0000001.1 artificial gene name (AGN), mRNA
ACGTTTACGACGT
>AB_0000002.1 artificial gene name (AGN), variant 1, mRNA
ACGTTTACGACGC
>AB_0000003.1 other artificial gene name (OAGN), variant 2, mRNA
ACGACTGCGACGG
>AB_0000003.1 other artificial gene name (OAGN), variant 3, mRNA
ACACACACACAC
>AB_0000004.1 other artificial gene name (OAGN), variant 4, mRNA
ACGACTGCGACGT
>AB_0000005.1 yet other artificial gene name (YOAGN), variant 1, mRNA
ACACACACACAC
>AB_0000006.1 yet other artificial gene name (YOAGN), variant 2, mRNA
ACACACACACAC
And we have a file transcriptomes.txt with the following content:
genes.fa
We use the following command to build a lookup table:
./build_lookup_table.py --poly_ACGT_len 6 --kmer_len 12 --transcriptomes transcriptomes.txt input.txt
And then query the transcriptome file itself:
./lookup_table query --report_fmt plain genes.fa lookup.slt o.txt
The content of o.txt will be:
1: ("genes.fa", "AGN"), 1: ("genes.fa", "AB_0000001.1")
1: ("genes.fa", "AGN"), 1: ("genes.fa", "AB_0000002.1")
3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"], "genes.fa": ["OAGN"]], 3: ["1.fa": ["h9"], "genes.fa": ["AB_0000003.1"]]
2: ("genes.fa", 3)
3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"], "genes.fa": ["OAGN"]], 1: ("genes.fa", "AB_0000004.1")
2: ("genes.fa", 3)
2: ("genes.fa", 3)
In the above example, the fasta file was used for the query, but one may also use compactors (--input_fmt compactors) file or main SPLASH output file result.after_correction.scores.tsv (--input_fmt extendors).
In the case of compactors, each compactor is treated as a separate sequence and results in one line in the output.
In the case of extendors, for each line in the input file (result.after_correction.scores.tsv) the anchor is taken and there are as many sequences built as there are targets.
For example, if there are three targets stored for each anchor there will be up to three lines in the output file for these targets (maybe less if a given anchor has fewer targets).
The result of a query may be extended using --stats_fmt with_stats.
In this case for each query after the standard result there will also be a summary of k-mers to category assignments.
The format is: <categor>: <number of k-mers in query in this category>
For example when the query is:
../bin/lookup_table query --report_fmt plain --stats_fmt with_stats 4.fa lookup.slt o.txt
The output is:
N, N, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1") 1: 2, 2: 0, 3: 0, 4: 0, U: 12, P: 0, N: 2
2: ("1.fa", 2) 1: 0, 2: 1, 3: 0, 4: 0, U: 0, P: 0, N: 0
P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]] 1: 0, 2: 0, 3: 1, 4: 0, U: 4, P: 1, N: 0
4 1: 0, 2: 0, 3: 0, 4: 1, U: 0, P: 0, N: 0
If only stats are of interest one may suppress the standard list with --report_fmt empty.
Warning: using --report_fmt empty with --stats_fmt empty (or not setting --stats_fmt at all) will result in output containing #queries empty lines.
When the input format is extendors (result.after_correction.scores.tsv) it is possible to set --output_fmt extendors. In this case additional columns are added.
For each most_freq_target_<i> column there will be a new column most_freq_extendor_<i>_query_res if report_fmt is plain or ids and most_freq_extendor_<i>_query_stats if stats_fmt is with_stats.
Warning: If both (report_fmt and stats_fmt) are empty the output will be exactly the same as input file.
When the input format is compactors it is possible to set --output_fmt compactors. In this case additional columns are added.
-
query_resifreport_fmtisplain,ids, orconcise -
query_statsifstats_fmtiswith_stats
Warning: If both (report_fmt and stats_fmt) are empty the output will be exactly the same as input file.
Lets assume we have following result.after_correction.scores.tsv SPLASH output:
anchor pval_opt effect_size_bin pval_base M anch_uniqTargs number_nonzero_samples target_entropy avg_no_homopolymer_targets avg_hamming_distance_max_target avg_hamming_distance_all_pairs avg_edit_distance_max_target avg_edit_distance_all_pairs most_freq_target_1 cnt_most_freq_target_1 most_freq_target_2 cnt_most_freq_target_2 pval_opt_corrected
CAACGACGACGACGTACACGACGACGA 1.26129e-21 0.213304 0.0218488 2639 54 342 1.27155 0 6.25161 7.40047 5.41455 6.40716 CGTACGCCGACGACGTGCTGAATGGCT 1520 CGTACGCCGACGTCGTCCTGTCGGGGT 1049 6.10416177521e-19
AGAGATGCTGGTGGCAGGGCAACGACG 9.0965e-07 0.14895 1 1333 36 177 1.27046 0 0.414854 0.535504 0.414854 0.535504 ACGACTTGGTTGTATCAACTATGAAGA 804 ACGACCTGGTTGTATCAACTATGAAGC 489 6.77285923852e-05
AGATGCTGGTGGCAGGGCATGAGAAAA 5.99838e-09 0.205298 1 1397 31 184 1.22632 0 0.778812 0.997034 0.778812 0.994373 AACGACTGCGACGCAACTATGAAGAGC 856 GCAATGGTTGTATCAACTATGAAGCGT 504 5.04867265421e-07
AGGACAGCAATGGTTGTGATGATGATG 1.6011e-22 0.234194 1 2116 48 275 1.31055 0 6.14272 6.99537 5.26701 5.99881 AAGAGCTCGTCCGCATGGTGCTGAATG 1171 AAGCGTTTGTGAGGCATATCCTGTCGG 881 1.33768977104e-19
We can run the following command:
./lookup_table query --input_fmt extendors --output_fmt extendors --report_fmt plain --stats_fmt with_stats result.after_correction.scores.tsv lookup.slt result.after_correction.scores.queried.tsv
-
--input_fmt extendorssays that the input is in SPLASH output format -
--output_fmt extendorssays that we want this same file with additional columns as the output -
--stats_fmt with_statssays we want to have also summary for each query
In such a case the resulting file result.after_correction.scores.queried.tsv is:
anchor pval_opt effect_size_bin pval_base M anch_uniqTargs number_nonzero_samples target_entropy avg_no_homopolymer_targets avg_hamming_distance_max_target avg_hamming_distance_all_pairs avg_edit_distance_max_target avg_edit_distance_all_pairs most_freq_target_1 cnt_most_freq_target_1 most_freq_target_2 cnt_most_freq_target_2 pval_opt_corrected most_freq_extendor_1_query_res most_freq_extendor_1_query_stats most_freq_extendor_2_query_res most_freq_extendor_2_query_stats
CAACGACGACGACGTACACGACGACGA 1.26129e-21 0.213304 0.0218488 2639 54 342 1.27155 0 6.25161 7.40047 5.41455 6.40716 CGTACGCCGACGACGTGCTGAATGGCT 1520 CGTACGCCGACGTCGTCCTGTCGGGGT 1049 6.10416177521e-19 U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U 1: 3, 2: 0, 3: 0, 4: 0, U: 40, P: 0, N: 0 U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 2, 2: 0, 3: 0, 4: 0, U: 41, P: 0, N: 0
AGAGATGCTGGTGGCAGGGCAACGACG 9.0965e-07 0.14895 1 1333 36 177 1.27046 0 0.414854 0.535504 0.414854 0.535504 ACGACTTGGTTGTATCAACTATGAAGA 804 ACGACCTGGTTGTATCAACTATGAAGC 489 6.77285923852e-05 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 0, U: 42, P: 0, N: 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 43, P: 0, N: 0
AGATGCTGGTGGCAGGGCATGAGAAAA 5.99838e-09 0.205298 1 1397 31 184 1.22632 0 0.778812 0.997034 0.778812 0.994373 AACGACTGCGACGCAACTATGAAGAGC 856 GCAATGGTTGTATCAACTATGAAGCGT 504 5.04867265421e-07 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, P, P, P, P, P, P, P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]], U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 1, 4: 0, U: 35, P: 7, N: 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 43, P: 0, N: 0
AGGACAGCAATGGTTGTGATGATGATG 1.6011e-22 0.234194 1 2116 48 275 1.31055 0 6.14272 6.99537 5.26701 5.99881 AAGAGCTCGTCCGCATGGTGCTGAATG 1171 AAGCGTTTGTGAGGCATATCCTGTCGG 881 1.33768977104e-19 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 1, U: 42, P: 0, N: 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 1, U: 42, P: 0, N: 0
If we don't define --output_fmt extendors i.e. we use:
./lookup_table query --input_fmt extendors --report_fmt plain --stats_fmt with_stats result.after_correction.scores.tsv lookup.slt result.after_correction.scores.queried.txt
we will have each result for extendor (anchor+target) as a separate line:
U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U 1: 3, 2: 0, 3: 0, 4: 0, U: 40, P: 0, N: 0
U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 2, 2: 0, 3: 0, 4: 0, U: 41, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 0, U: 42, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 43, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, P, P, P, P, P, P, P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]], U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 1, 4: 0, U: 35, P: 7, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 43, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 1, U: 42, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 1, U: 42, P: 0, N: 0
The software will look for columns with names anchor and most_freq_target_<number> and build extendor for each pair of anchor + target.
Lets say we have a compactors output file compactors.queried.txt:
anchor compactor support exact_support extender_specificity num_extended
AAAAACAAGACTGGGGCTGCTCCCATC ACGACGACGACTANACGACGACGACGTACGCCGACGACGAAAAAACGACTGCGACGTGATGATGATGAAAAAACAAGACTG 570381 358915 0.944578 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAAGTTCTGGGAAGGGAAAGCTCCCAA 916 193 0.870968 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAGTTCTGGGAAAGGGAAAGCTCCCAA 446 298 0.001254 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATACGACGTACGCCGACGAGCTACTACAAAGTTCTGGGAAAAGGGAAAGCTCCC 300 117 1.000000 0
AAAAACAAGACTGGGGCTGCTCCCATC AAACGACGACGACTGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAAAGTTCTGGGAAAGGGAAAGCTCCC 246 148 0.307692 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGCTACTACAAAGTTCTGGGAAAGGGAAAGCTCCCAA 165 80 0.001254 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAATGATGATGATGACTGCTCCCATCATTGATGATGATGATGAGGCTACTACAACGACGACGACTAGGGAAAGCTCCCAA 105 49 0.001254 0
We can run the following command:
./lookup_table query --input_fmt compactors --output_fmt compactors --report_fmt plain --stats_fmt with_stats compactors.out.tsv lookup.slt compactors.queried.tsv
-
--input_fmt compactorssays that the input is in COMPACTORS output format -
--output_fmt compactorssays that we want this same file with additional columns as the output -
--stats_fmt with_statssays we want to have also summary for each query
In such a case the resulting file compactors.queried.tsv is:
anchor compactor support exact_support extender_specificity num_extended query_res query_stats
AAAAACAAGACTGGGGCTGCTCCCATC ACGACGACGACTANACGACGACGACGTACGCCGACGACGAAAAAACGACTGCGACGTGATGATGATGAAAAAACAAGACTG 570381 358915 0.944578 0 2: ("1.fa", 2), U, N, N, N, N, N, N, N, N, N, N, N, N, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1"), U, U, U, U, U, P, P, P, P, P, P, P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]], U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, P, P, P, P, P, P, P, U, U 1: 2, 2: 1, 3: 1, 4: 1, U: 39, P: 14, N: 12
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAAGTTCTGGGAAGGGAAAGCTCCCAA 916 193 0.870968 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAGTTCTGGGAAAGGGAAAGCTCCCAA 446 298 0.001254 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATACGACGTACGCCGACGAGCTACTACAAAGTTCTGGGAAAAGGGAAAGCTCCC 300 117 1.000000 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
AAAAACAAGACTGGGGCTGCTCCCATC AAACGACGACGACTGGCTGCTCCCATCATTGATGTGGTGCGATCGGGCTACTACAAAAGTTCTGGGAAAGGGAAAGCTCCC 246 148 0.307692 0 U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 0, U: 69, P: 0, N: 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGCTACTACAAAGTTCTGGGAAAGGGAAAGCTCCCAA 165 80 0.001254 0 U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
AAAAACAAGACTGGGGCTGCTCCCATC AAAATGATGATGATGACTGCTCCCATCATTGATGATGATGATGAGGCTACTACAACGACGACGACTAGGGAAAGCTCCCAA 105 49 0.001254 0 U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 3, U: 66, P: 0, N: 0
If we don't define --output_fmt compactors i.e. we use:
./lookup_table query --input_fmt compactors --report_fmt plain --stats_fmt with_stats compactors.out.tsv lookup.slt compactors.queried.txt
we will have each result for compactor as a separate line:
2: ("1.fa", 2), U, N, N, N, N, N, N, N, N, N, N, N, N, 1: ("1.fa", "h1-cat_1"), U, U, U, U, U, U, U, U, U, U, U, U, 1: ("2.fa", "h1-cat_1"), U, U, U, U, U, P, P, P, P, P, P, P, U, U, U, U, 3: ["1.fa": ["h4-cat_3"], "2.fa": ["h5-cat_3"]], U, U, U, U, U, U, U, U, U, U, U, 4, U, U, U, U, P, P, P, P, P, P, P, U, U 1: 2, 2: 1, 3: 1, 4: 1, U: 39, P: 14, N: 12
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 0, U: 69, P: 0, N: 0
U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 0, 3: 0, 4: 0, U: 70, P: 0, N: 0
U, U, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 4, U, U, 4, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, U, 2: ("1.fa", 2), U, U, U, U, U, U, U, U, U, U, U, U, U, U, U 1: 0, 2: 1, 3: 0, 4: 3, U: 66, P: 0, N: 0
Lexicographically smaller of the k-mer and its reverse complement is the so-called canonical k-mer. In the index, canonical k-mers are used. When queries are performed all k-mers are also transformed to the canonical form.