Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

14 Commits
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Pattern Buffer 🧮

Fast pattern counting on small-alphabet sequences with GPU acceleration, built on PyTorch.

Originally designed to count patterns in DNA sequences with ambiguous bases as defined by the IUPAC code, but can be extended to any pattern counting task where the original sequences and target patterns can be converted into a sensible categorical encoding.

Note

The preface of "small-alphabet" sequences is given as the additional memory used by categorical encoding grows with the number of unique values in the alphabet. With DNA and IUPAC encoding this is tractable because many of the codes represent combinations of DNA bases, so despite there being 15 DNA nucleotide codes we only need to embed in a vector of length 4 (A, C, G, T).

Usage

Pattern Buffer can be used with a broadly functional or object-oriented (OO) interface, with the functional interface geared towards one-time use and the OO interface for use multiple times (i.e. file parsing or PyTorch DataLoaders).

To demonstrate, we'll first create some sample sequences and queries. As we're using IUPAC nucleotide sequences, we can use the provided generate_iupac_embedding function to provide the embedding tensor.

from pattern_buffer import generate_iupac_embedding
sequences = [
    "AACGAATCAAAAT",
    "AACAGTTCAAAAATTAGT",
    "AGTTCGYGGA",
    "AACAAGATCAGGAAAGCTGACTTGATG",
]
query_seqs = ["AAA", "AGT", "AAACA", "AAR", "GYGGA"]
embedding = generate_iupac_embedding()

From here, we can use the function count_queries to count the queries in a single function call:

from pattern_buffer import count_queries
count_queries(sequences, queries, embedding)
# tensor([[0, 0, 0, 0, 0],
#         [3, 1, 0, 3, 0],
#         [0, 1, 0, 0, 1],
#         [1, 0, 0, 3, 0]])

or create an instance of the PatternBuffer class, and use the .count method to count occurrences in new sequences. This has the advantage of not re-calculating the query embeddings or the support tensor each time, so is well suited for fast repeated counting:

from pattern_buffer import PatternBuffer
pb = PatternBuffer(query_strings=queries, embedding=embedding)
pb.count(sequences)
# tensor([[0, 0, 0, 0, 0],
#         [3, 1, 0, 3, 0],
#         [0, 1, 0, 0, 1],
#         [1, 0, 0, 3, 0]])

Limitations

  • If all of your patterns contain unique (non-ambiguous) characters then this encoding scheme is likely overkill and other software would be more efficient.
  • The software is designed for use with GPU acceleration, and will likely under-perform on CPU when compared to CPU-optimised counting schemes.

Future work

  • Allow dynamic input lengths with padding
  • Automatic encoding detection from pattern analysis
  • FFT-based convolutions for long patterns

About

🧮 Fast pattern counting on small-alphabet sequences with GPU acceleration

Resources

Stars

Watchers

Forks

Releases

Packages

Used by

Contributors

Languages