dimer motif

[jflucier]

Hi,

I am trying to replicate ecoli CRP - CMP - DNA conformation shift in an attempt to design new CRP.

CRP is a dimer. Is it possible to provide a dimer as motif? If yes, how can I do this?
I have sucessfully designed using a single CRP motif but CMP is not at the right spot

My current YAML:

num_states: 4

motifs:
  - 4n9h.3state  # Index 0: Unbound/Off-state template structure (from motifs/4n9h.pdb)

states:
  # State 0: Standalone Protein R (Off-conformation) - Completely Empty State
  - []

  # State 1: Inactive Bound Complex R·L2 (cAMP loaded, no DNA)
  - ["ccd:CMP", "ccd:CMP"]

  # State 2: Negative Selection State R*·DNA (Leaky DNA Prevention - No cAMP)
  # Pass both DNA forward and reverse strands using the clean 'dna:' identifier string
  - ["dna:CTTTTTTCCTAAAATGTGATCTAGATCACATTTTAGGAAAAAAG"]

  # State 3: Active On-State Complex R*·L2·DNA (Fully Bound Complex)
  # Pass both small molecule ligand entries along with both nucleic acid strands
  - ["ccd:CMP", "ccd:CMP", "dna:CTTTTTTCCTAAAATGTGATCTAGATCACATTTTAGGAAAAAAG"]


losses:
  # === State 0: Enforce Off-conformation folding ===
  - type: MotifLoss
    motif: 0  # Anchor against 4n9h scaffold
    state: 0

  # === State 1: Allow pocket structural shift with ligand ===
  - type: LigandContactLoss
    state: 1

  # === State 2: FORCE PUSH AWAY (Anti-Affinity if cAMP is missing) ===
  - type: AntiLigandContactLoss
    state: 2 # Penalize protein-DNA contacts if cAMP is missing
    weight: 1.5   # Up-weighted to aggressively eliminate leaky baseline affinity
  - type: AntiMotifLoss
    motif: 0  # Force it to stay locked in the inactive 4n9h shape if cAMP is missing
    state: 2

  # === State 3: Lock Active Geometry (On-state complete assembly) ===
  - type: AntiMotifLoss
    motif: 0  # FORCE THE SHIFT: Actively penalize the inactive shape when fully bound
    state: 3
  - type: LigandContactLoss
    state: 3 # Force tight contacts to cAMP and DNA simultaneously

please note that 4n9h.3state pdb is the 2 chain pdb (2 x CRP)

Thanks for your help